Electropherogram quality analysis - Help

  • This suite of program analyse the sequences generated by the automatic sequencer and gives the quality using Phred ("Reads DNA sequencer trace data, calls bases, assigns quality values to the bases, and writes the base calls and quality values to output files") package using a web browser interface.

  • The files to be analised should be "zipped" (*.zip format). For windows based systen use 'winzip' program to zip de files. For Linux system use a 'zip' command.

  • The user can see the quality at a glance (see example)

  • The vectors used for screening is updated monthly from NCBI ftp site or a specific vector sequence can be added by the system administrator.

  • Selecting a group of sequences, the user can run a CAP3 program (A DNA Sequence Assembly Program).

    Any comment or suggestion e-mail to: 

    
The following sequence is an example with the output coloured by the quality range. 
At the end is shown an eletropherogram for this read:


>A01.esd

    
TCTTGATGGCTAAGGAGTTGACATACTTCGCTAAGGCCCTGGAAAACCCTG
TCAGACCATTCTTGGCCATCCTTGGTGGCGCTANNAGGTTTCTNGAACCNA
AGNANTTCNNNAATTGATTGACAATTTNTGCCGGACCAAGGTNCCGGNATT
NNCCTATCCCNAAANNTNCCCNAATTNTTCGGGGGGNTTNGGGGGGGGGGC
CAAANGGGCGCAACACTCCGCGGCCCCNTTTTTCTTCTTTCCCCAAACCCT
TNNTTCTCC
    __ quality lower than 10
    __ quality between 10 and 20
    __ quality between 21 and 30
    __ quality higher than 31
    A01.esd Eletropherogram

    If you see this text, it means that you are not using a java capable browser.Sorry!

    Developed by: